{"lab": {"@id": "/labs/job-dekker-lab/", "status": "current", "uuid": "3c577664-affb-41c4-bf27-9e21c2fc1554", "title": "Job Dekker, UMMS", "@type": ["Lab", "Item"], "display_title": "Job Dekker, UMMS", "correspondence": [{"contact_email": "am9iLmRla2tlckB1bWFzc21lZC5lZHU=", "@id": "/users/83b5073a-069b-4162-9b30-6f42d5551e34/", "display_title": "Job Dekker"}], "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.3c577664-affb-41c4-bf27-9e21c2fc1554"]}}, "award": {"project": "4DN", "status": "current", "@type": ["Award", "Item"], "center_title": "NOFIC - Dekker", "uuid": "ae6c618f-7a8c-441e-a886-e30bbbe591da", "@id": "/awards/1U54DK107980-01/", "description": "NOFIC: The spatial organization of the genome impinges on all genomic processes, including gene regulation, maintenance of genome stability and chromosome transmission to daughter cells. A detailed understanding of the spatial arrangement of the human genome, referred to as the 4D nucleome, and the biological and physical principles that drive chromosome folding requires combining approaches from the fields of molecular and cell biology, imaging, genetics and genomics with approaches from physics, computational biology, and computer simulation. We have assembled a highly interdisciplinary center with the goal of generating extensively validated maps of the 4D nucleome, its physical and dynamic properties and its role in regulating the activity of the genome. First, the center will further optimize and extensively validate a suite of genome-wide molecular methodologies, based on chromosome conformation capture (3C) that can probe the folding of chromosomes at the scale of single nucleosomes, chromatin fibers, chromosomes and the entire nucleus, across cell populations and in single cells. Given that chromosome and nuclear organization is tightly linked to biological state of the cell, the center will map the 4D nucleome for four key biological states representing different conformations during the cell cycle (interphase and mitosis), and during cell differentiation (pluripotent and differentiated states). We will obtain complementary data regarding the structure and dynamics of chromatin, at different length scales and in single cells using extensive high-throughput imaging, live cell imaging and super resolution microscopy. Data obtained with all approaches will be analyzed, integrated and modeled using a set of methods we will further develop to gain insights into the structure, physics and dynamics of chromosome folding over different length scales. Finally, a critical component of our proposal is the biological validation and further elaboration of the chromatin interaction maps that are generated from our conformational analyses. This validation will be achieved through site-specific editing of genomic sequence and epigenetic marks, the creation of new contact points within the genome, and the identification of factors (both protein and nucleic acid) that facilitat or restrict these interactions. Effects of such perturbations in the chromosome conformation on transcription will reveal relationships between specific chromosome structural features and gene expression.", "name": "1U54DK107980-01", "display_title": "CENTER FOR 3D STRUCTURE AND PHYSICS OF THE GENOME", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "aliases": ["dekker-lab:Modification_AAVS1-mEGFP"], "guide_rnas": ["GGGGCCACTAGGGACAGGAT"], "description": "Engineered mGFP in to AAVS1 locus in human WTC cells.", "date_created": "2019-10-31T17:44:02.549753+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2019-11-22T20:09:30.369940+00:00"}, "target_of_mod": [{"uuid": "f1636daa-b17a-450e-8c79-14eb23713e44", "display_title": "AAVS1 gene with C-terminus mEGFP", "@id": "/bio-features/f1636daa-b17a-450e-8c79-14eb23713e44/", "status": "released", "@type": ["BioFeature", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "insertion", "public_release": "2019-11-22", "schema_version": "2", "project_release": "2019-11-22", "modification_type": "Crispr", "@id": "/modifications/25e102f7-e9a4-4be1-ae8b-1694b5a89041/", "@type": ["Modification", "Item"], "uuid": "25e102f7-e9a4-4be1-ae8b-1694b5a89041", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "Crispr insertion for AAVS1 gene with C-terminus mEGFP", "external_references": [], "modification_name": "Crispr insertion for AAVS1 gene with C-terminus mEGFP", "modification_name_short": "AAVS1 insertion", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}